|
Revvity
ivis spectrum in vivo imaging system Ivis Spectrum In Vivo Imaging System, supplied by Revvity, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/IVIS+optical+imaging+platform/10__1158_slash_0008___5472__can___19___2288-64-6-12 Average 96 stars, based on 1 article reviews
ivis spectrum in vivo imaging system - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Bethyl
rabbit anti rack1 ![]() Rabbit Anti Rack1, supplied by Bethyl, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/RACK1+Antibody/pmc08481097-407-41-44 Average 92 stars, based on 1 article reviews
rabbit anti rack1 - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Thermo Fisher
housekeeping gene glyceraldehyde 3 phosphate dehydrogenase ![]() Housekeeping Gene Glyceraldehyde 3 Phosphate Dehydrogenase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/Phosphate/pm20108057-33-19-43 Average 99 stars, based on 1 article reviews
housekeeping gene glyceraldehyde 3 phosphate dehydrogenase - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
AUTODOCK GmbH
vina 1.1.2 software ![]() Vina 1.1.2 Software, supplied by AUTODOCK GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/vina+1+1+2+software/pmc07699345-156-14-13 Average 90 stars, based on 1 article reviews
vina 1.1.2 software - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
OriGene
n a 50 nd1 qpcr ctagcagaaacaaaccgggc quiros ![]() N A 50 Nd1 Qpcr Ctagcagaaacaaaccgggc Quiros, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/MT+ND1+(ND1)+Human+qPCR+Primer+Pair/pm37541209-216-47-65 Average 91 stars, based on 1 article reviews
n a 50 nd1 qpcr ctagcagaaacaaaccgggc quiros - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Bio-Quant inc
bioquant nova prime software ![]() Bioquant Nova Prime Software, supplied by Bio-Quant inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/bioquant+nova+prime+software/pmc06622016-150-35-39 Average 90 stars, based on 1 article reviews
bioquant nova prime software - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Revvity
ivis lumina xr imaging platform ![]() Ivis Lumina Xr Imaging Platform, supplied by Revvity, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/IVIS+Lumina+LT+In+Vivo+Imaging+System/pmc10169838-315-9-14 Average 93 stars, based on 1 article reviews
ivis lumina xr imaging platform - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Revvity
ivis spectrum ![]() Ivis Spectrum, supplied by Revvity, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/Living+Image+Software/ppr0218141-115-10-25 Average 97 stars, based on 1 article reviews
ivis spectrum - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
Addgene inc
rplpo forward primer ![]() Rplpo Forward Primer, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/gRNA_Cloning+Vector+(Plasmid+%2341824)/pm28388431-228-34-30 Average 96 stars, based on 1 article reviews
rplpo forward primer - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Psychology Software Tools
e prime 3 0 software ![]() E Prime 3 0 Software, supplied by Psychology Software Tools, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/E-Prime/pmc12477440-134-24-27 Average 99 stars, based on 1 article reviews
e prime 3 0 software - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Cytiva Europe
probequant g 50 micro columns ![]() Probequant G 50 Micro Columns, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/illustra+ProbeQuant+G-50+Micro+Columns/pmc07391607-1549-91-95 Average 96 stars, based on 1 article reviews
probequant g 50 micro columns - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
PRIMER-E
permanova ![]() Permanova, supplied by PRIMER-E, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+5%2E0+software/permanova/10__3390_slash_agronomy10030333-113-7-10 Average 90 stars, based on 1 article reviews
permanova - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports
Article Title: The N-terminal domain of SARS-CoV-2 nsp1 plays key roles in suppression of cellular gene expression and preservation of viral gene expression
doi: 10.1016/j.celrep.2021.109841
Figure Lengend Snippet: Nsp1 N-terminal and central domain mutants are defective for ribosome and mRNA binding (A) HEK293T cells were transfected with plasmids expressing WT or the indicated mutant 3xFLAG-Halo-tagged nsp1. Nsp1 was immunoprecipitated (IP) using ⍺-FLAG beads and coIP of ribosomal proteins RACK1, RPS2, RPS3, and RPS24 was monitored by western blotting, with vinculin serving as a loading control. Input lanes contain 1/10 of the amount of protein used for the IPs. (B) Equilibrium binding measurements of fluorescently labeled WT (blue), R124A,K125A (red), and R99A (green) nsp1 to purified ribosomes. Data represent a total of 3 biological replicates. (C) HEK293T cells were co-transfected with HBB-nLuc and either a control plasmid or the indicated 3xFLAG-Halo-tagged nsp1 constructs. Technical triplicate measurements were taken for each biological replicate. A total of at least three biological replicates were taken for each measurement. Nsp1 was immunoprecipitated using ⍺-FLAG beads, whereupon the co-immunoprecipitating RNAs were extracted and nLuc mRNA was quantified by qRT-PCR. The mRNA values were then normalized to the values obtained from the empty vector control. Each dot represents an independent experiment. ∗ p ≤ 0.05, ∗∗ p ≤ 0.01; one-way ANOVA followed by Dunnett’s multiple comparisons test versus WT nsp1. The bars represent the mean value of the replicates and error bars represent standard deviation. (D) HEK293T cells were co-transfected with a 3xFLAG-Halo-tagged nsp1 plasmid or empty vector control, together with a plasmid expressing either GFP with a 5′ stem loop (GFP+SL) or a control GFP lacking the stem loop (GFP). Nsp1 was immunoprecipitated using ⍺-FLAG beads, whereupon the co-immunoprecipitating GFP+SL or GFP mRNAs were quantified by qRT-PCR. The mRNA values were then normalized to those obtained from the empty vector control. The bars represent the mean value of the replicates and error bars represent standard deviation. (E) The levels of GFP+SL and GFP mRNA present in the input samples from (D) were quantified by qRT-PCR and normalized to 18S rRNA, with the level of GFP mRNA in cells lacking nsp1 (empty vector control) set to 1. Each dot represents an independent experiment. ∗∗ p ≤ 0.01; unpaired t test. See also , , and . The bars represent the mean value of the replicates and error bars represent standard deviation.
Article Snippet: The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000, Abcam GR268234-50), mouse anti-FLAG M2 (1:1000, Sigma-Aldrich SLBT7654), rabbit anti-RPS2 (1:2000, Bethyl labs A303-794A-M), rabbit anti-RPS3 (1:500, Proteintech 11990-1-AP), rabbit anti-RPS24 (1:1000, Bethyl labs A303-842A-T),
Techniques: Binding Assay, Transfection, Expressing, Mutagenesis, Immunoprecipitation, Western Blot, Labeling, Purification, Plasmid Preparation, Construct, Quantitative RT-PCR, Standard Deviation
Journal: Cell Reports
Article Title: The N-terminal domain of SARS-CoV-2 nsp1 plays key roles in suppression of cellular gene expression and preservation of viral gene expression
doi: 10.1016/j.celrep.2021.109841
Figure Lengend Snippet:
Article Snippet: The following antibodies were used for western blotting: mouse anti-GFP (1:5000; Clontech 632381), rabbit anti-Vinculin (1:1000, Abcam GR268234-50), mouse anti-FLAG M2 (1:1000, Sigma-Aldrich SLBT7654), rabbit anti-RPS2 (1:2000, Bethyl labs A303-794A-M), rabbit anti-RPS3 (1:500, Proteintech 11990-1-AP), rabbit anti-RPS24 (1:1000, Bethyl labs A303-842A-T),
Techniques: Magnetic Beads, Recombinant, Protease Inhibitor, Transfection, Luciferase, SYBR Green Assay, Primer Extension Assay, Clone Assay, Software
Journal: Nature Communications
Article Title: Post-translational covalent assembly of CAR and synNotch receptors for programmable antigen targeting
doi: 10.1038/s41467-023-37863-5
Figure Lengend Snippet: a In vivo experimental design. b IVIS imaging of tumor burden over time. c Quantification of tumor growth via luciferase intensity for mouse images in b . “PR” indicates partial response which is defined by a final tumor size over baseline but <10 9 at day 33 (relative light units, RLU). d Survival of treated mice over time. For d a Mantel-Cox log-rank test was performed with a Bonferroni correction for multiple comparisons and “ * ” denotes a significance of p < 0.01667 for three comparisons, n = 5 mice. Exact p -values are p = 0.0135 for adaptor only and p = 0.0031 for SNAP-CAR T cells only. Source data are available as a Source Data file.
Article Snippet: Luminescence in mice was acquired and quantified using the
Techniques: In Vivo, Imaging, Luciferase